*Exchange rate ref. BCCR. The supplier can change the price of the product. Aeropost is an online shopping services provider. Total price includes all charges . NM_c+A>G; NM_c+A>T . ss, BGI|BGI_rs, fwd/B, C/T, aatggcaaaatgataaattgtggtcttctg. ss, BGI|BGI_rs, rev/B, G/T, ctgttgagtgaaggctgtgttcttggaggg, agtattctttgaataaactgatgaattcca, 06/06/08, 06/18/09, , Genomic, unknown.
Author: | Voodoozil Faezuru |
Country: | Angola |
Language: | English (Spanish) |
Genre: | Science |
Published (Last): | 13 September 2013 |
Pages: | 220 |
PDF File Size: | 12.55 Mb |
ePub File Size: | 6.44 Mb |
ISBN: | 800-8-37814-491-3 |
Downloads: | 20018 |
Price: | Free* [*Free Regsitration Required] |
Uploader: | Shazilkree |
Kinetic evidence for an anion binding pocket in the active site of nitronate monooxygenase. C ]; O2 [CPD: Related articles in Web of Science Google Scholar.
The enzyme from Escherichia coli attacks a broad spectrum of phenolic compounds.
Here, we provide whole genome sequencing, assembly, and gene annotation of the lined seahorse, which can enrich genome resource and further application for its molecular breeding. ExplorEnz – The Enzyme Database: The enzymes from the fungus Neurospora crassa and the yeast Williopsis saturnus var.
Sponsors of Barbados Gospelfest 2018 “Touching Lives Changing Nations”
Using homology-based, de novo and transcriptome-based prediction methods, we predicted 20 protein-coding genes in the generated assembly, which is less than our previously reported gene number 23 of the tiger tail seahorse H. Availability of supporting data.
NAD P H reductase subfamily. In progress issue alert.
Reference SNP (refSNP) Cluster Report: rs
Xun L, Sandvik ER. C ]; O2 [CPD: J Biol Chem Neither hydrogen peroxide nor superoxide were detected during enzyme turnover. ExplorEnz – The Enzyme Database: Email alerts New issue alert.
Re analyzing community-wide datasets without major infrastructure. Published by Oxford University Press.
Preços referenciais B3 – prêmios de opções
We report a draft genome of the lined seahorse. In order to improve the aquaculture yield of this valuable fish species, we are trying to develop genomic resources for assistant selection in genetic breeding.
Bpet Bpet Bpet Bpet J Biol Chem Draft genome of the lined seahorse, Hippocampus erectus Qiang Lin. Characterization of the anthranilate degradation pathway in Geobacillus thermodenitrificans NG Involvement of a flavosemiquinone in the enzymatic oxidation of nitroalkanes catalyzed by 2-nitropropane dioxygenase.
Active towards linear alkyl nitronates of lengths between 2 and 6 carbon atoms and, with lower activity, towards propylnitronate.
Characterization of an Escherichia coli aromatic hydroxylase with a broad substrate range. Bbgi contig N50 and scaffold N50 reached Oxford University Press is a department of the University of Oxford. Crystal structure of 2-nitropropane dioxygenase complexed with FMN and substrate.
Sign In or Create an Account. Oxidoreductases; Acting on single donors with incorporation of molecular oxygen oxygenases ; With incorporation of one atom of oxygen internal monooxygenases or internal mixed-function oxidases.
Molecular characterization of 4-hydroxyphenylacetate 3-hydroxylase of Escherichia coli. GigaScienceVolume 6, Issue 6, 1 Junegix, https: